Weeks 13 & 14 & 15 Lab 28: Virtual Screening Virtual screening was conducted alongside the in vitro experiments. Table 1 shows the GOLD screening results of screening 10 positive and 6 negative control ligands. This screen was used to validate that GOLD screened the positive controls high, since they are known to bind well to the protein, and score the random ligands lower, because they are just random ligands and should be lower than the known positive controls. As seen in table 1, GOLD scored most of the positive controls higher than the negative controls which validates GOLD to be used to find novel ligands to be tested in vitro. Table 2 shows the top 30 ligands were kept and researched to determine if they followed Lipinski’s rule (only until 10 ligands that followed Lipinski's was found).
The positive control and the high scoring novel ligand contain a similar tail that end with a carboxylate group, however the novel ligand is much bigger and contains a ring structure. The novel ligand does not share any similarities with the negative control at all. Figures 28.1, 28.2, and 28.3 show the ligands docking pose in the active site of STPP2B. The positive control and the novel ligand form many hydrogen bonds with the active site residues and the ring structure of the novel ligand also has hydrophobic interactions with hydrophobic residues in the active site. The negative control does not have any polar contacts, nor does it fit into the active site as well as the other two ligands. The negative control barely fits inside the active site as it is to bulky and probably can’t completely go into the active site due to steric hinderance because of the bulky 2 rings it contains.
Fig 28.3. Pymol image of best scoring novel ligand (that followed Lipinski’s rule), ID #: SAM001246840, in the active site of STPP2B. The active site is shown with carbons labeled green, and the novel ligand’s carbons as purple. Polar contacts is shown as dashed black lines, the novel ligand makes 8 polar contacts with waters (not shown) and the active site residues.
Fig 28.2. Pymol image of negative control ligand, ID #: 36690577, in the active site of STPP2B. The active site is shown with carbons labeled green, and the negative control ligand’s carbons as cyan. The negative control ligand does not make any polar contacts with the active site nor with surrounding water molecules of STPP2B.
Fig 28.1. Pymol image of positive control ligand, ID #: 10921447, in the active site of STPP2B. The active site is shown with carbons labeled green, and the positive control ligand’s carbons as cyan. Polar contacts is shown as dashed black lines, the positive control makes 7 polar contacts with waters (not shown) and the active site residues.
Table 2. GOLD analysis results including GOLD scores from screening 4 libraries (NIH, ChemBridge, InHouseCompounds, and HF 9 Plates 5-9). The top 30 ligands from the screening of the various libraries are shown, 10 of which are known to follow Lipinski’s rule of 5. The ligands and their information labeled blue is from the NIH library, the ligand labeled in black is from the HF9 plates 5-9, and the ligand in green is from the InHouseCompounds. The compounds labeled red are from the ChemBridge library.
Table 1. GOLD scores and other relevant information from GOLD screening of 10 positive controls and 6 negative control. Positive controls are shown as green, negative controls are shown as red. The ligands are placed in order according to greatest to smallest GOLD scores. Positive controls were found from BindingDB and the negative controls were found from the ZINC database.
Lab 27: Inhibition Assay (YopH)
Inhibition assay was run using the surrogate protein, YopH, with the compound 5250098. The first row was the no enzyme control which was used to determine if the spectrophotometer read the absorbance of any of the reagents used in the samples. Row 2 and 3 were the negative controls because they contained no substrate and should show the highest absorbance value because the enzyme is able to break down the most pNPP. The last row, was the positive inhibitor control which contained the enzyme along with a known inhibitor Orthovanidate. This control is important to compare how well the compound 5250098 is inhibiting compared to a strong inhibitor. As seen in the graph below, as the concentration of 5250098 increases, the absorbance is varied and is about the same as the negative controls. This means that compound 5250098 is not a good inhibitor of the YopH enzyme and won't be useful to use as a drug.
Figure 27.1. Inhibition Assay of YopH using various concentrations of compound 5250098. Concentration of inhibitor vs absorbance values shown with standard deviation error bars. Results shown are an average of 2 conducted runs.
Lab 26: Enzyme Assay using surrogate (YopH)
An enzyme assay was run using the surrogate protein YopH to determine the enzyme activity with various concentrations of the protein. 5 samples were run, 1 that contained no enzyme and 4 that contained increasing concentrations of enzyme (0.125, 0.5, 1, and 1.5 ng/uL). According to the graph shown below, as the concentration of the protein increased, the higher the enzymatic activity was, which was seen by the increasing absorbance. The last reading was a bit lower due to human error, probably from pipetting something wrong accidentally. With this data, we can conclude that the YopH protein is functional and is breaking down pNPP to form the yellow colored substrate. The next step would be to take the concentration of enzyme that showed a large signal (high absorbance value) to inhibition assay to test novel ligands against the protein and determine if the ligands are capable of inhibiting the enzyme.
Fig 26.1. Enzyme Assay of YapH with various concentrations of enzyme (0.125, 0.5, 1, and 1.5 ng/uL). Absorbance measured using a red tide spectrophotometer (Luke).
Lab 25: Protein Characterization
Samples throughout protein expression and purification were taken to determine the presence of STPP2B protein in every step. This is done to make sure that the elution sample contains the STPP2B protein and only the protein. If it is not found in the elution sample, then it was probably lost in a previous step and that step can be redone in hopes to purify the protein. My gel was sadly destroyed in the drying process and a previous picture was not taken. Protein characterization will be done again next week to determine if the STPP2B protein was in the elution sample.
Figure 25.2. ColorPlus Prestain Protein Ladder.
Figure 25.1. Destroyed PAGE gel after characterization. Ladder on first row, samples 1-6 on the next 7 rows.
Lab 24: Protein Purification
The pH of the clarified lysate was brought down to a pH value of 7.87 by adding HCl. The clarified lysate was purified via Ni-NTA affinity purification to obtain pure STPP2B protein. The STPP2B protein contains a 5-6x histidine tag that the Nickel in the Ni-NTA complex will bind to. The clarified lysate was flowed through a 20 mL Bio Lab chromatography column, then a wash buffer was flown through, and an elution buffer was flown through twice. The STPP2B protein will be washed down with the elution buffer, which contains a high concentration of imidazole, that will break the strong bonding between the nickel and the histidine tag. The wash buffer contains a low concentration of imidazole which will allow the proteins with a few histidine to flow through into a waste beaker. The elution buffer flow through was saved and nanodropped to determine the concentration of STPP2B protein obtained. The Molar Extinction Coefficient is 0.75 L/mol cm. Using Beer's Law, the concentration of STPP2B protein in elution 1 is 0.11mg/mL and the total amount of protein is 0.44mg because 4mL of elution buffer was used in the column. The concentration of STPP protein in elution 2 is 0.04mg/mL and the total amount of protein is 0.16mg/mL. Most of the protein was found in elution 1, meaning the protein eluted well, however the concentration of protein is a little low. The next step would be to characterize the protein in a PAGE gel to determine what is in the elution sample.
Figure 24.2. Nanodrop results of elution 2 in protein purification. The absorbance at 280nm is 0.029.
Figure 24.1 Nanodrop results of Elution 1 from protein purification. The absorbance of the sample at 280nm is 0.08.
Lab 23: Protein Expression
Positively cloned plasmid was obtained from a partner and transformed into BL21 (DE3) strain of E. Coli bacteria. This strain of bacteria is competent for protein translation as opposed to the DH5A that was competent for DNA replication. This will allow the STPP2B gene to be over expressed greatly in the bacteria cells. Option B was used to express the protein. The protein was expressed by growing a small culture in a 500 mL flask overnight with Kanamycin to kill off bacteria that don't contain the plasmid and any other contaminant bacteria. A total of 15 mL of the small culture sample was added to a large 2L flask containing 500 mL of LB to reach an OD(600) value of 0.148. The large culture was then allowed to grow for 110 minutes to obtain an OD(600) value of 0.515 (the OD(600) value was checked every 30 minutes until it reached approx. 0.5). IPTG was added to the large culture and then underwent the induction step for 4 hours. The cells was harvested by centrifuging and then lysed by using a sonicator. The cell lysate was then spun down again and filtered using a 0.45 um PES syringe filter.
Figure 23.1. Vernier Visible Spectrophotometer (Chipper) OD(600) results of obtaining an OD(600) value of 0.515 in 110 minutes. Only 4 measurements were saved.
Weeks 11 & 12 Lab 22: Virtual Screening:
The STPP2B protein was prepped for GOLD to be able to run the libraries against. There was no active site for the homology model, thus a dummy ligand model had to be used to determine and create an active site.
Fig 22.2 STPP2b Protein with a dummy ligand in the active. The active site was found using the dummy ligand model. The protein is shown as cartoon, and the dummy ligand is shown as sticks with the carbons yellow.
Fig 22.1. Overall image of the STPP2B protein, made from a homology model using the PDB structure for calcineurin (PDB: 1m63).
Lab 21: DNA Sequencing Results
The plasmids were purified from the colonies that were grown on the master plates via mini prep. Then the plasmids were sent to sequencing after adding pLIC primers (Forward and Reverse) to each sample. The results were obtained and sent back within 2-3 days. The results show that all of the colonies contained plasmids, however they all did not have the STPP2B inserted into the plasmid. Three trials of DNA cloning were attempting and research was continued using partner's positive clones. Max Score: 24.7 Total Score: 47.7 Query Coverage: 1% E Value: 0.060 Ident: 89% Accession: 138479
Colony 3 Results: Negative Alignment statistics for match #1||~ Score
Lab 20: Mini Prep of Plasmid
The colonies obtained after cloning from the master plate were mini prepped to obtain the plasmid in preparation to send to DNA sequencing and for transforming BL21 strain of E. Coli bacteria. A sample of each colony's plasmid was nanodropped to figure out the yield of plasmid DNA. According to my results, all of my plasmid concentrations from each colony was really high: 228.1, 289.0, and 272.2 ng/uL respectively for colonies 1, 2, and 3. The solution was also contaminated a bit based on the 260/280 and 260/230 values.
Figure 20.3. Nanodrop Results of pNIC-Bsa4 after mini prep of colony 3 from master plate. Possibly contains STPP2B gene.
Figure 20.2. Nanodrop Results of pNIC-Bsa4 after mini prep of colony 2 from master plate. Possibly contains STPP2B gene.
Figure 20.1. Nanodrop Results of pNIC-Bsa4 after mini prep of colony 1 from master plate. Possibly contains STPP2B gene.
Weeks 9 & 10 Great job this week. Keep it up. - BN Lab 19: Making Master Plate
Colonies were taken from transformation plate and grown again on separate master plate. Rest of colonies used to grow huge amounts of E. Coli in tubes and the bacteria were spinned down and mini prepped to obtain pure DNA sample. The DNA sample will be sent to DNA sequencing next week to determine if cloning was successful.
Figure 19.1 Master Plate containing BL21 E. Coli that has been transformed with pNIC-Bsa4 (with STPP-2B gene). Plates made of Kanamycin + 5% Sucrose. 3 colonies on plate.
Lab 18: Annealing & Transformation
The process of annealing and transformation include inserting the PCR insert into the accepting vector and transforming the vector into E. Coli bacteria. The ratio of PCR insert to accepting vector used that produced colonies was 4 to 1. A master plate will be made with these colonies and a sample of the colonies will be prepped and sent to DNA sequencing to determine if STPP-2B gene transformed into the bacteria.
Cloning - Trial 3
Trial 3 of cloning results after 48 hours of incubation at 37 degrees Celsius. Three colonies grew after annealing and transformation, if cloning worked the E. Coli should contain the STPP-2B gene and the next step would be to express the protein.
Figure 18.2 Plate containing BL21 E. Coli that has been transformed with pNIC-Bsa4 (with STPP-2B gene). Plates made of Kanamycin + 5% Sucrose. 3 colonies formed
Cloning - Trial 2
Trial 2 of cloning results after 24 hours of incubation at 37 degrees Celsius. Trial failed because colonies failed to grow. Possible sources of error include killing bacteria in heat shock due to incorrect measurement of temperature (didn't use thermometer).
Figure 18.1 Plate containing BL21 E. Coli that has been transformed with pNIC-Bsa4 (with STPP-2B gene). Plates made of Kanamycin + 5% Sucrose.
Cloning - Trial 1
Trial 1 failed because colonies were accidentally grown on LB plates. However, nothing grew on the plates. Possible sources of error include not having sucrose to allow bacteria to recuperate after undergoing the stress of heat shock. Lab 17: Building a Homology Model for STPP-2B
Since there was no crystal PDB structure of STPP-2B, a homology model was created to make a model of the protein (STPP-2B) to be able to find potential inhibitors of the protein using virtual screening. The homology model was made using the crystal structure of calcineurin cyclophilin (1m63A) and the homology model was tested and verified using MolProbity to make sure the homology model created was acceptable for virtual screening.
Figure 18.4. Swiss-Model Alignment of 1M63A with protein encoding STPP-2B.
Figure 18.3. Swiss-Model Results of PDB structures similar to STPP-2B.
Figure 18.2. Table of MolProbity Analysis results of Homology Model of STPP-2B.
Figure 18.1. Table of MolProbity Analysis of Template PDB Crystial Structure (1M63)
Excellent! Nice analysis. -UM Weeks 7 & 8 Lab 17: Cohesion End Generation & Annealing
Cohesion end generation is the step before annealing that is required in order to anneal. The accepting vector and the inserting vector are both cut at the ends in such a way so that they are able to bind together to form a plasmid with the protein gene inserted. To check if my protein target DNA has been accepted by the pNIC-Bsa4 plasmid, the cultures will be grown and a sample will be sent off to DNA sequencing to determine the sequence of the plasmid gene. However in these steps, colonies failed to grow after annealing and incubating at 37 degrees Celsius overnight. The failure was probably due to heat shocking the E. Coli incorrectly which led to the bacteria to not be transformed and their deaths by the sucrose + kanamycin. Cloning will be redone again next week with the same sample of pNIC, hopefully the error was due to human error and not because of the low concentration of pNIC. Lab 16: Restriction Enzyme Cutting of pNIC-Bsa4
The purpose of this lab is to cut out the SecB gene from the accepting vector so that the protein gene (STPP2B) of my target protein is able to bind to the plasmid and can be cloned inside E. Coli bacteria. The restriction enzyme Bsa1 cuts at the site where the SecB gene is and where my target protein gene will enter in the annealing step of the cloning protocol. The concentrations seen below however are pretty low so annealing may not work due to very low concentrations of the accepting vector. The next step in the protocol is to generate the cohesive ends of the accepting vector (pNIC) and the inserting vector (target protein) so that they can be annealed or glued together. The plasmid will then be transformed in E. Coli bacteria (DH5Alpha) and the culture will be grown on a plate.
Figure 16.3. Nanodrop results after cutting out SecB gene from pNIC-Bsa4. Concentration is 32.5 ng/uL.
Figure 16.2. Nanodrop results of pNIC-Bsa4 after cutting out SecB gene. Concentration is 25.3 ng/uL.
Figure 16.1. Gel Image of pNIC-Bsa4 after Restriction Enzyme cutting to separate the SecB gene from pNIC. 1kb ladder on lane 2, and 2 samples on lanes 5 and 6.
Lab 15: Transformation of pNIC-Bsa4 into E. Coli (DH5Alpha) [Midi Prep Results]
The pNIC-Bsa4 plasmid was transformed into E. Coli (DH5Alpha) strain of bacteria by heat shocking to open the pores of the bacteria to allow the plasmid to get inside and ice shocking the bacteria to keep the pores closed. The culture was grown on a plate and a single colony was grown in LB media over-night to obtain a large amount of E.Coli bacteria that have pNIC transformed in them due to making a negative selective media by adding Kanamycin (plasmid contains gene for kanamycin resistance). The E. Coli cells were lysed and the plasmid DNA was extracted via Midi Prep and the results were examined on the Nanodrop to determine the concentration of plasmid DNA obtained. The next step would be to determine if the concentration is high enough and proceed to cutting the plasmid and inserting the STPP2B gene into the plasmid to prepare for cloning. DH5Alpha E. Coli cells were used for this step because this strand of E. Coli is manufactured to have a higher yield in replication.
Figure 15.2. Nanodrop results of pNIC-Bsa4 after midi prep of DNA after over night growth of a culture.
Figure 15.1. Nanodrop results after midi prep of pNIC-Bsa4 after growing an over-night culture. Concentration is 38.3.
Lab 14: PCR Clean Up (Nanodrop Results)
PCR clean up was done on PCR squared samples to extract pure DNA after overlap PCR to obtain just the DNA of the protein (STPP2B) sample. PCR clean up also purifies the solution to get rid of any PCR contaminants that might have been left over after the overlap PCR procedures. The 260/280 value shows the amount of contamination by proteins that is seen after cleanup (should be around 1.9). The 260/230 value shows the amount of other contaminants in the sample after cleanup (should be around 2.1). Two trials were conducted and averaged to ensure accurate reading by the nanodrop. The next step is to grow up pNIC-Bsa4, the accepting vector, in order to be able to clone the protein DNA in E. Coli.
Figure 14.2. Nanodrop results after PCR cleanup of STPP2B. Concentration of pure DNA is 84.8 ng/uL.
Figure 14.1. Nanodrop Results after PCR Clean up of STPP2B from P. Vivax. Concentration is 83.2 ng/uL.
Good job! Very organized and good analysis. Keep up the awesome job and I wish you the best of luck in cloning! - Michael T. Weeks 5 & 6 Lab 13: Transformation Lab
E. Coli bacteria (DH5 Alpha) were transformed by heat shocking the plasmid DNA (pNIC Bsa-4) into the bacteria at 42 degrees Celsius for exactly 45 seconds. The bacteria were then placed on ice for 2 minutes. Then the bacteria were placed on plates with SOC media to allow them to recuperate from the stress of heat shock and give them time to divide. The heat shock is important because it creates pores in the bacterial cell membrane to allow the plasmid DNA to travel into the bacteria cells. The bacteria are then placed on ice to allow the cell membrane to close and give the bacteria time to incorporate the plasmid DNA to their own DNA. The results shown below are the results of bacterial growth after 16 hours of incubation at 37 degrees Celsius.
Figure 13.2. Transformation results of E. Coli (DH5 Alpha) bacteria transformed with pNIC Bsa-4, also contains SOC media (50 uL of mixture initially added).
Figure 13.1. Transformation results of E. Coli (DH5 Alpha) bacteria transformed with pNIC Bsa-4, also contains SOC media (10 uL of mixture initially added).
Lab 12: PCR Squared
The PCR Squared results shown below in figure 12.1 were a failure due to the fact that the gel ran incorrectly. The ladder and the next 5 PCR squared results failed to correctly run down the gel. Error probably due to incorrect gel preparation, bad pipetting technique, or using TBE by accident. Lanes 7, 8, and 9 worked however but the size of the DNA is unknown due to the ladder failing. PCR squared will be redone, and samples from lanes 6-9 will be reran to test and see if they worked correctly.
Figure 12.1. PCR Squared results. Lane 1 is the 1kb ladder, lane 2-9 are PCR squared results. Gel run results skewed for lanes 1-6.
Lab 11: Primary & Secondary PCR Redo
Samples from previous PCR was lost and Primary and Secondary PCR was redone. Primary PCR results both worked due to the large fuzzy bands seen throughout the 3.0kb to 0.5kb range. Secondary PCR results both worked because the brightest bands are in between the 2.0kb and 1.5kb on the ladder (size of my DNA is 1695 base pairs long). There seems to be more contamination on the Secondary PCR on lane 6, however, and thus the lane 5 secondary PCR results will be used as the template for PCR Squared.
Figure 11.1. Primary and Secondary PCR results redone. Lane 1 is 1kb ladder, lanes 3 and 4 are Primary PCR, and Lanes 5 and 6 are Secondary PCR.
Lab 10: Secondary PCR
The first Secondary PCR trial, shown in figure 10.1 was a failure. The Secondary PCR looked like a Primary PCR result, which means the Q5 polymerase was not able to latch together the range of DNA nucleotide sequences made in Primary. The second Secondary PCR trial, shown in figure 10.2 was somewhat of a success. The brightest band seen is perfectly at the size of my DNA sequence (1695 nucleotides long), shown in between the 2.0kb and 1.5kb size on the 1kb ladder.However there are other faint bands seen, which are signs of contaminants and gel extraction might have to be done to refine the DNA after PCR Squared.
Figure 10.2 Secondary PCR results. Lane 1 is 1kb ladder, lane 2 is secondary PCR. The prevalent band seen above is inbetween the 2.0kb and 1.5 kb range.
Figure 10.1. Secondary PCR results. Lane 1 is 1kb ladder and lane 3 is secondary PCR.
Lab 9: Primary PCR (Worked)
Primary PCR results show a hazy band that is prevalent from 2.0kb to 100 bp area, however most of the DNA seems to be residing at the bottom. The DNA that is seen at the bottom of the band is probably the tail primers that didn't latch onto the DNA of the protein properly. This Primary PCR result is acceptable, however, because there is a substantial amount of DNA around the 500 bp region, meaning the tail primers were able to latch onto the STPP-2b DNA and the polymerase was able to synthesize bands which will be further refined to my DNA size in secondary PCR.
Fig 9.1. Primary PCR results. Lane 6 is the 100bp ladder, lane 8 is Primary PCR results.
Week 3 & 4
Gautam - good work. Include a ladder image. Move analysis outside of the caption - Dr. B 092513
Lab 8: Primary PCR
Trials 1 & 2. Primary PCR was run twice, both of which failed. The first trial, no bands showed up at all. The second trial, a small blurry trail showed at bottom, but probably only is a clump of primers found below and not the actual piece of DNA required before running Secondary PCR. Third trial will be run next week.
Fig 8.2 Primary PCR Gel Trial 2. 100 Base Pair ladder in lane 1, Primary PCR in lane 4. Little band shown at bottom, but not enough to be successful.
Fig 8.1. Gel Image of Primary PCR trial 1. 100 Basepair ladder shown, no bands found for Primary PCR run.
Lab 7: Tail Primer Design
Tail Primers were created that had similar melting points within 0.5 degrees Celcius of each other. Purpose of lab is to make tail primers to order and also to insert the gene sequence of P. Vivax STTP-2B into pNIC BSA-4. Forward Primer: TACTTCCAATCCATGGAACCGCTCCCAAATCCA Reverse Primer: CGCCCACCGAACGAATGACAGTAAAGGTGGATA Lab 6: Oligo Mix Dilution
Oligonucleotide mix was made using 42 wells from the box. Final volume was 100uL. Lab 5: RE Digest & Redo PCR Results
Restriction Enzymes EcoRI and PvuII were used to cleave DNA at different restriction sites. The further the bands travelled, the shorter the DNA strands were. The 1KB ladder was used to show the different sizes for the DNA strands.
Fig 5.1. Lanes 1 through 5 are from RE digest and are the 1kb ladder, sample a, b, c, and d respectively. The different sizes of the band show the different sizes of DNA cuts made by the Restriction Enzymes EcoRI and PvuII.
Week 1 & 2
Gautam , good job, include image of your failed gel.. Re-do PCR - Dr. B 090913
Lab 4: PCR and Agarose Gel Preparation
Results from first attempt Failed. Probably due to not diluting the Taq before adding it into the samples.
Fig 4.1. PCR Results from first failed attempt. Lane 1 is the 1kb ladder, lane 2 is sample b, lane 3 is sample c, and lane 4 is sample d. Sample A was missing before gel was run. Results from this gel run show no bands, which means the run failed.
42 oligonucleotides need to be synthesized ---------------------------------------------------------------- 1 ATGGAGCCACTGCCAAACCCGAAGAATGATCGTCAGGTTAAGGATGTTGA 50 2 AGAGCAGCTCCAGAGACAGTGGTTTTGCTGGTGGTGGTTCAACATCCTTAACCTGACGAT 60 3 CTGTCTCTGGAGCTGCTCTACCCGAACGGTACGGACGAGCCACCGGATTACAAGGCTCTG 60 4 CCTCTTTACGGATACGACCTTCTTTTTTGAGATGATCACGCAGAGCCTTGTAATCCGGTG 60 5 AAGGTCGTATCCGTAAAGAGGACTGTCTGGACATTATCAAACGTGTTATCGACATCGTAT 60 6 ATCGGGTCCTGCAGACGCAGGAGGTTCGGTTCGTTAGATACGATGTCGATAACACGTTTG 60 7 CGTCTGCAGGACCCGATTACCATCGTTGGCGACATCCATGGCCAGTACTACGACTTCCTG 60 8 ACTGAGTGTTGTCCGGGTTACCACCTACCTCCAGGAGTTTCAGGAAGTCGTAGTACTGGC 60 9 ACCCGGACAACACTCAGTTTCTCTTCCTGGGTGACTACGTCGACCGTGGCTCTTTTTCTA 60 10 AAGTTAATCTTGAGGGCGTACAGGAGGAGCAGGACTTCGATAGAAAAAGAGCCACGGTCG 60 11 TGTACGCCCTCAAGATTAACTTCCCGCACAAAATCTGGCTGATCCGTGGCAACCACGAAT 60 12 TCGCACTCGTCACGAAAGTTGAAAAAGGAGGTCATCTGACGGCATTCGTGGTTGCCACGG 60 13 CTTTCGTGACGAGTGCGAATACAAATACGACATGGTTGTTTACTACGCGTTCATGGAATC 60 14 TACCGTTGATAACCGCAGACAGCGGGATGGTGTCGAAAGATTCCATGAACGCGTAGTAAA 60 15 GTCTGCGGTTATCAACGGTAAATTCCTGGCCGTTCACGGTGGTCTGTCTCCACAGCTGGT 60 16 GCTCTTGAAAACGGGTAAAGCTGCAGATTTGGTTCAGCAGAACCAGCTGTGGAGACAGAC 60 17 GCTTTACCCGTTTTCAAGAGCCGCCACGCTCTGGTATTTTCTGTGACATCCTGTGGGCAG 60 18 CGGTCTGGATGGTATGTTCTTCTTTGTCTTCGTCGATTGGATCTGCCCACAGGATGTCAC 60 19 AAGAACATACCATCCAGACCGAATCTTACTTTCCGAATGATATCCGCGGCTGTTCCTACT 60 20 CCGTTTTTTTCCAGAAAAGTGGTCGCTGCGTTGTAACCGAAAAAGTAGGAACAGCCGCGG 60 21 CCACTTTTCTGGAAAAAAACGGTCTGCTGTCTATCATCCGTGCCCACGAGGCGCAACTGG 60 22 CGGGAAACCGGTCTTCAGGTTGGTTTGGTGCATCTTATAACCTTCCAGTTGCGCCTCGTG 60 23 CTGAAGACCGGTTTCCCGATCGTTATCACTATCTTCTCTGCACCGAACTATTGCGACGTA 60 24 TGTTAGAGTCGAATTTCAGAACCGCACCTTTGTTATTGTATACGTCGCAATAGTTCGGTG 60 25 GGTTCTGAAATTCGACTCTAACACCCTGAACATCCAGCAGTTCTCTTTCTCTCCGCACCC 60 26 GAGACCAGGTAAACAGGTTCATAAAGTTCGGGAGGTGATAAGGGTGCGGAGAGAAAGAGA 60 27 TGAACCTGTTTACCTGGTCTCTGCCGTTTGTTAGCGAAAAGGTGACCGAAATGCTGTACT 60 28 ACACCTTCGTCAGACTGGTTAACAGAAGAGTTCAGAATGCAGTACAGCATTTCGGTCACC 60 29 ACCAGTCTGACGAAGGTGTTAAAGATGTCGTTCTGCCTGCCGAAGTTCTGCAAATTATCT 60 30 CATACCCTCGAGTTTAACGTTGTTTTCTTCGATGTAAGAGATAATTTGCAGAACTTCGGC 60 31 CAACGTTAAACTCGAGGGTATGACCCTGAGCGGTGGCGGTGGTGCGACTGCCGGTGCGGC 60 32 TTCCTTACGTTGAGAAGACGGAGAACCTTCGGTAGCACCAGTGGATGCCGCACCGGCAGT 60 33 CCGTCTTCTCAACGTAAGGAAGCCCTCTTCAAAGAGGGTTGCTTTCACTCTGGTGCCAGC 60 34 GCCGCTGCCGGAGACGTGGTACCCAGGGCACCGCCTTCCTTGCTGGCACCAGAGTGAAAG 60 35 GTCTCCGGCAGCGGCGACGGCTACCACCCAGCAGATGGCAGCGCAAGGTGAGCAACCGGC 60 36 AGAACGCTCTTTAGACGCCTGCGCGTCGTCGGTGTGCAGGTGTGCCGGTTGCTCACCTTG 60 37 GGCGTCTAAAGAGCGTTCTGACGCGCTCCGCAAAAAGGTTCAATCTGTTGGCCGTCTCAT 60 38 AATCAGTTCATTTTCTTTGCGCAGAGTACGGAAAACACGCATGAGACGGCCAACAGATTG 60 39 GCGCAAAGAAAATGAACTGATTGTTCAACTCAAAGGTTGTTCTCCAGGTTACCGCATTCC 60 40 CGTTCTCGAGGCCCTCCTTGCCCTGCAGCAGGAGACCTACCGGAATGCGGTAACCTGGAG 60 41 GGAGGGCCTCGAGAACGAACTCGAAAAATTCACTAAAGCTAAACAGATCGACAGCATCAA 60 42 TTACTCGTTCGGAGGACGTTTTTCATTGATGCTGTCGATCTGTTTAG 47 Figure 3.1: Primer Design sequence used to order Oligonucleotides. The primer sequence of Serine/Threonine Protein Phosphatase 2B, putative in P. Vivax that was codon optimized for E. Coli class II.
Week 1 Lab 2: DNA Sequence Sent to DNA Sequencing Facility: DNA Plasmid: pGBR-22 using M13F DNA Sequence: NNNNNNNNNNNNNGGCGATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCCGCGGGATTTTAGTGATGGTGATGGTGATGACCGAGCAAAGAGTGGCGTGCAATGGATATTTCACACTGCTCAACA AATGTGTAATCCTTGTTGTGACTGGTTACATCCAGTTTGCGGTCAACATAGTGATACCCTGGCATCCTCACAGGCTTCTTTGCCTTGTAAGTAGATTTGAATTCACACAAATAGTAACCACCTCCTTCCAACTTCA GAGCCATAAAGTTGTTTCCTATCAGCATTCCATCTCGTGCAAAGAGACGCTCAGTGTTGGGTTCCCAGCCCTGTGTCTTCTTCTGCATAACAGGTCCATTGGGAGGAAAGTTCACACCAGAGATTTTGACATTG TAGATGAAACAGTTGCCTTGGATGCTGGAATCATTGCTGACAGTACACACTGCACCATCTTCAAAGTTCATGATCCTCTCCCATGTATATCCCTCAGGGAATGACTGCTTTACATAATCAGGGATGTCTTCAGG GTACTTGGTGAATGGTATGCTTCCGTATTGAGACAGTGGTGATAAAATATCCCAAGCAAATGGCAGAGGTCCACCCTTGGTGACAGTGAGCTTTACCGTCTGCTCCCCCTCGTAAGGCTTTCCTTTTCCATCG CCTTCGACCTCAAAGTAGTGTCCATTGACCGTGCCTGACATATAAACCTTGTANGTCATTTGTTTAGCGATCACACTCATGATATTTCTCCTTCAATCAATCAAAATCACTAGTGCGGCCGCCTGCAGGTCGAC CATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCNCTCACAATTCCACACAACAT ACNAGCCGGAAGCATAAAGTGNAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCNCATTAATTGCGTTGCNCTCACTGCCNGCTTNCNGTNGGAAANCTGTCGTGNNGCTGCNNNNNNANNNNNNNCN CGGGGNNNNGNNGNTNGCNTNTGGGNNNTNNNNNNNNCGNNNNNNGANTCNNNNCNNNNNNNCNTNNGNNGCGGNNNNNNGNNTCNNNTNNNNNNNNNNNNNNNGNNNNNNNNNNAANTCNNG NNNNNCNNAANNNNNNNNNNNNNNNNNNNNNNNNANCNNNNNNNCNNNNTNNNNNNTNNNNNNNNNNNN
Figure 2.1: DNA sequence of pGBR-22 using primer M13-Forward. Results were obtained from DNA Sequencing Lab. A,G,C,T represent base pairs while N represents base pairs that sequencing lab was unable to distinguish.
Lab 1: Nanodrop:
Figure 1.2: Nanodrop measurement 2 used to determine concentration of pGBR-22 as well as the purity of it (260/280 & 260/230). The concentration measured was 206.8 ng/uL. The 260/280 value determines the purity of the DNA in respect to proteins while the 260/230 value shows the purity of DNA in comparison to other contaminates. Ideally these two values should be at 1.8 and 2.1 respectively.
Figure 1.1: First Nanodrop measurement used to determine concentration of pGBR-22 as well as the purity of it (260/280 and 260/230 values). The concentration recorded was 202.8 ng/uL The 260/280 value recorded was 1.98 which shows the purity of the DNA with respect to proteins while the 260/230 value which was recorded at 1.83 shows the purity of DNA with respect to other small contaminants.
Lab 28: Virtual Screening
Virtual screening was conducted alongside the in vitro experiments. Table 1 shows the GOLD screening results of screening 10 positive and 6 negative control ligands. This screen was used to validate that GOLD screened the positive controls high, since they are known to bind well to the protein, and score the random ligands lower, because they are just random ligands and should be lower than the known positive controls. As seen in table 1, GOLD scored most of the positive controls higher than the negative controls which validates GOLD to be used to find novel ligands to be tested in vitro. Table 2 shows the top 30 ligands were kept and researched to determine if they followed Lipinski’s rule (only until 10 ligands that followed Lipinski's was found).
The positive control and the high scoring novel ligand contain a similar tail that end with a carboxylate group, however the novel ligand is much bigger and contains a ring structure. The novel ligand does not share any similarities with the negative control at all. Figures 28.1, 28.2, and 28.3 show the ligands docking pose in the active site of STPP2B. The positive control and the novel ligand form many hydrogen bonds with the active site residues and the ring structure of the novel ligand also has hydrophobic interactions with hydrophobic residues in the active site. The negative control does not have any polar contacts, nor does it fit into the active site as well as the other two ligands. The negative control barely fits inside the active site as it is to bulky and probably can’t completely go into the active site due to steric hinderance because of the bulky 2 rings it contains.
Lab 27: Inhibition Assay (YopH)
Inhibition assay was run using the surrogate protein, YopH, with the compound 5250098. The first row was the no enzyme control which was used to determine if the spectrophotometer read the absorbance of any of the reagents used in the samples. Row 2 and 3 were the negative controls because they contained no substrate and should show the highest absorbance value because the enzyme is able to break down the most pNPP. The last row, was the positive inhibitor control which contained the enzyme along with a known inhibitor Orthovanidate. This control is important to compare how well the compound 5250098 is inhibiting compared to a strong inhibitor. As seen in the graph below, as the concentration of 5250098 increases, the absorbance is varied and is about the same as the negative controls. This means that compound 5250098 is not a good inhibitor of the YopH enzyme and won't be useful to use as a drug.
Lab 26: Enzyme Assay using surrogate (YopH)
An enzyme assay was run using the surrogate protein YopH to determine the enzyme activity with various concentrations of the protein. 5 samples were run, 1 that contained no enzyme and 4 that contained increasing concentrations of enzyme (0.125, 0.5, 1, and 1.5 ng/uL). According to the graph shown below, as the concentration of the protein increased, the higher the enzymatic activity was, which was seen by the increasing absorbance. The last reading was a bit lower due to human error, probably from pipetting something wrong accidentally. With this data, we can conclude that the YopH protein is functional and is breaking down pNPP to form the yellow colored substrate. The next step would be to take the concentration of enzyme that showed a large signal (high absorbance value) to inhibition assay to test novel ligands against the protein and determine if the ligands are capable of inhibiting the enzyme.
Lab 25: Protein Characterization
Samples throughout protein expression and purification were taken to determine the presence of STPP2B protein in every step. This is done to make sure that the elution sample contains the STPP2B protein and only the protein. If it is not found in the elution sample, then it was probably lost in a previous step and that step can be redone in hopes to purify the protein. My gel was sadly destroyed in the drying process and a previous picture was not taken. Protein characterization will be done again next week to determine if the STPP2B protein was in the elution sample.
Lab 24: Protein Purification
The pH of the clarified lysate was brought down to a pH value of 7.87 by adding HCl. The clarified lysate was purified via Ni-NTA affinity purification to obtain pure STPP2B protein. The STPP2B protein contains a 5-6x histidine tag that the Nickel in the Ni-NTA complex will bind to. The clarified lysate was flowed through a 20 mL Bio Lab chromatography column, then a wash buffer was flown through, and an elution buffer was flown through twice. The STPP2B protein will be washed down with the elution buffer, which contains a high concentration of imidazole, that will break the strong bonding between the nickel and the histidine tag. The wash buffer contains a low concentration of imidazole which will allow the proteins with a few histidine to flow through into a waste beaker. The elution buffer flow through was saved and nanodropped to determine the concentration of STPP2B protein obtained. The Molar Extinction Coefficient is 0.75 L/mol cm. Using Beer's Law, the concentration of STPP2B protein in elution 1 is 0.11mg/mL and the total amount of protein is 0.44mg because 4mL of elution buffer was used in the column. The concentration of STPP protein in elution 2 is 0.04mg/mL and the total amount of protein is 0.16mg/mL. Most of the protein was found in elution 1, meaning the protein eluted well, however the concentration of protein is a little low. The next step would be to characterize the protein in a PAGE gel to determine what is in the elution sample.
Lab 23: Protein Expression
Positively cloned plasmid was obtained from a partner and transformed into BL21 (DE3) strain of E. Coli bacteria. This strain of bacteria is competent for protein translation as opposed to the DH5A that was competent for DNA replication. This will allow the STPP2B gene to be over expressed greatly in the bacteria cells. Option B was used to express the protein. The protein was expressed by growing a small culture in a 500 mL flask overnight with Kanamycin to kill off bacteria that don't contain the plasmid and any other contaminant bacteria. A total of 15 mL of the small culture sample was added to a large 2L flask containing 500 mL of LB to reach an OD(600) value of 0.148. The large culture was then allowed to grow for 110 minutes to obtain an OD(600) value of 0.515 (the OD(600) value was checked every 30 minutes until it reached approx. 0.5). IPTG was added to the large culture and then underwent the induction step for 4 hours. The cells was harvested by centrifuging and then lysed by using a sonicator. The cell lysate was then spun down again and filtered using a 0.45 um PES syringe filter.
Weeks 11 & 12
Lab 22: Virtual Screening:
The STPP2B protein was prepped for GOLD to be able to run the libraries against. There was no active site for the homology model, thus a dummy ligand model had to be used to determine and create an active site.
Lab 21: DNA Sequencing Results
The plasmids were purified from the colonies that were grown on the master plates via mini prep. Then the plasmids were sent to sequencing after adding pLIC primers (Forward and Reverse) to each sample. The results were obtained and sent back within 2-3 days. The results show that all of the colonies contained plasmids, however they all did not have the STPP2B inserted into the plasmid. Three trials of DNA cloning were attempting and research was continued using partner's positive clones.
Max Score: 24.7
Total Score: 47.7
Query Coverage: 1%
E Value: 0.060
Ident: 89%
Accession: 138479
Colony 3 Results: Negative
Alignment statistics for match #1||~ Score
Query 1 ATGGAACCGCTCCCAAAT 18 ||||||||||| || ||| Sbjct 105 ATGGAACCGCTGCCGAAT 122Colony 2 Results: Negative
Alignment statistics for match #1||~ Score
Query 1 ATGGAACCGCTCCCAAAT 18 ||||||||||| || ||| Sbjct 104 ATGGAACCGCTGCCGAAT 121 </span>Colony 1 Results: Negative
Alignment statistics for match #1||~ Score
Query 1 ATGGAACCGCTCCCAAAT 18 |||||||||||||| ||| Sbjct 158 ATGGAACCGCTCCCGAAT 14Lab 20: Mini Prep of Plasmid
The colonies obtained after cloning from the master plate were mini prepped to obtain the plasmid in preparation to send to DNA sequencing and for transforming BL21 strain of E. Coli bacteria. A sample of each colony's plasmid was nanodropped to figure out the yield of plasmid DNA. According to my results, all of my plasmid concentrations from each colony was really high: 228.1, 289.0, and 272.2 ng/uL respectively for colonies 1, 2, and 3. The solution was also contaminated a bit based on the 260/280 and 260/230 values.
Weeks 9 & 10
Great job this week. Keep it up. - BN
Lab 19: Making Master Plate
Colonies were taken from transformation plate and grown again on separate master plate. Rest of colonies used to grow huge amounts of E. Coli in tubes and the bacteria were spinned down and mini prepped to obtain pure DNA sample. The DNA sample will be sent to DNA sequencing next week to determine if cloning was successful.
Lab 18: Annealing & Transformation
The process of annealing and transformation include inserting the PCR insert into the accepting vector and transforming the vector into E. Coli bacteria. The ratio of PCR insert to accepting vector used that produced colonies was 4 to 1. A master plate will be made with these colonies and a sample of the colonies will be prepped and sent to DNA sequencing to determine if STPP-2B gene transformed into the bacteria.
Cloning - Trial 3
Trial 3 of cloning results after 48 hours of incubation at 37 degrees Celsius. Three colonies grew after annealing and transformation, if cloning worked the E. Coli should contain the STPP-2B gene and the next step would be to express the protein.
Cloning - Trial 2
Trial 2 of cloning results after 24 hours of incubation at 37 degrees Celsius. Trial failed because colonies failed to grow. Possible sources of error include killing bacteria in heat shock due to incorrect measurement of temperature (didn't use thermometer).
Cloning - Trial 1
Trial 1 failed because colonies were accidentally grown on LB plates. However, nothing grew on the plates. Possible sources of error include not having sucrose to allow bacteria to recuperate after undergoing the stress of heat shock.
Lab 17: Building a Homology Model for STPP-2B
Since there was no crystal PDB structure of STPP-2B, a homology model was created to make a model of the protein (STPP-2B) to be able to find potential inhibitors of the protein using virtual screening. The homology model was made using the crystal structure of calcineurin cyclophilin (1m63A) and the homology model was tested and verified using MolProbity to make sure the homology model created was acceptable for virtual screening.
Excellent! Nice analysis. -UM
Weeks 7 & 8
Lab 17: Cohesion End Generation & Annealing
Cohesion end generation is the step before annealing that is required in order to anneal. The accepting vector and the inserting vector are both cut at the ends in such a way so that they are able to bind together to form a plasmid with the protein gene inserted. To check if my protein target DNA has been accepted by the pNIC-Bsa4 plasmid, the cultures will be grown and a sample will be sent off to DNA sequencing to determine the sequence of the plasmid gene. However in these steps, colonies failed to grow after annealing and incubating at 37 degrees Celsius overnight. The failure was probably due to heat shocking the E. Coli incorrectly which led to the bacteria to not be transformed and their deaths by the sucrose + kanamycin. Cloning will be redone again next week with the same sample of pNIC, hopefully the error was due to human error and not because of the low concentration of pNIC.
Lab 16: Restriction Enzyme Cutting of pNIC-Bsa4
The purpose of this lab is to cut out the SecB gene from the accepting vector so that the protein gene (STPP2B) of my target protein is able to bind to the plasmid and can be cloned inside E. Coli bacteria. The restriction enzyme Bsa1 cuts at the site where the SecB gene is and where my target protein gene will enter in the annealing step of the cloning protocol. The concentrations seen below however are pretty low so annealing may not work due to very low concentrations of the accepting vector. The next step in the protocol is to generate the cohesive ends of the accepting vector (pNIC) and the inserting vector (target protein) so that they can be annealed or glued together. The plasmid will then be transformed in E. Coli bacteria (DH5Alpha) and the culture will be grown on a plate.
Lab 15: Transformation of pNIC-Bsa4 into E. Coli (DH5Alpha) [Midi Prep Results]
The pNIC-Bsa4 plasmid was transformed into E. Coli (DH5Alpha) strain of bacteria by heat shocking to open the pores of the bacteria to allow the plasmid to get inside and ice shocking the bacteria to keep the pores closed. The culture was grown on a plate and a single colony was grown in LB media over-night to obtain a large amount of E.Coli bacteria that have pNIC transformed in them due to making a negative selective media by adding Kanamycin (plasmid contains gene for kanamycin resistance). The E. Coli cells were lysed and the plasmid DNA was extracted via Midi Prep and the results were examined on the Nanodrop to determine the concentration of plasmid DNA obtained. The next step would be to determine if the concentration is high enough and proceed to cutting the plasmid and inserting the STPP2B gene into the plasmid to prepare for cloning. DH5Alpha E. Coli cells were used for this step because this strand of E. Coli is manufactured to have a higher yield in replication.
Lab 14: PCR Clean Up (Nanodrop Results)
PCR clean up was done on PCR squared samples to extract pure DNA after overlap PCR to obtain just the DNA of the protein (STPP2B) sample. PCR clean up also purifies the solution to get rid of any PCR contaminants that might have been left over after the overlap PCR procedures. The 260/280 value shows the amount of contamination by proteins that is seen after cleanup (should be around 1.9). The 260/230 value shows the amount of other contaminants in the sample after cleanup (should be around 2.1). Two trials were conducted and averaged to ensure accurate reading by the nanodrop. The next step is to grow up pNIC-Bsa4, the accepting vector, in order to be able to clone the protein DNA in E. Coli.
Good job! Very organized and good analysis. Keep up the awesome job and I wish you the best of luck in cloning! - Michael T.
Weeks 5 & 6
Lab 13: Transformation Lab
E. Coli bacteria (DH5 Alpha) were transformed by heat shocking the plasmid DNA (pNIC Bsa-4) into the bacteria at 42 degrees Celsius for exactly 45 seconds. The bacteria were then placed on ice for 2 minutes. Then the bacteria were placed on plates with SOC media to allow them to recuperate from the stress of heat shock and give them time to divide. The heat shock is important because it creates pores in the bacterial cell membrane to allow the plasmid DNA to travel into the bacteria cells. The bacteria are then placed on ice to allow the cell membrane to close and give the bacteria time to incorporate the plasmid DNA to their own DNA. The results shown below are the results of bacterial growth after 16 hours of incubation at 37 degrees Celsius.
Lab 12: PCR Squared
The PCR Squared results shown below in figure 12.1 were a failure due to the fact that the gel ran incorrectly. The ladder and the next 5 PCR squared results failed to correctly run down the gel. Error probably due to incorrect gel preparation, bad pipetting technique, or using TBE by accident. Lanes 7, 8, and 9 worked however but the size of the DNA is unknown due to the ladder failing. PCR squared will be redone, and samples from lanes 6-9 will be reran to test and see if they worked correctly.
Lab 11: Primary & Secondary PCR Redo
Samples from previous PCR was lost and Primary and Secondary PCR was redone. Primary PCR results both worked due to the large fuzzy bands seen throughout the 3.0kb to 0.5kb range. Secondary PCR results both worked because the brightest bands are in between the 2.0kb and 1.5kb on the ladder (size of my DNA is 1695 base pairs long). There seems to be more contamination on the Secondary PCR on lane 6, however, and thus the lane 5 secondary PCR results will be used as the template for PCR Squared.
Lab 10: Secondary PCR
The first Secondary PCR trial, shown in figure 10.1 was a failure. The Secondary PCR looked like a Primary PCR result, which means the Q5 polymerase was not able to latch together the range of DNA nucleotide sequences made in Primary. The second Secondary PCR trial, shown in figure 10.2 was somewhat of a success. The brightest band seen is perfectly at the size of my DNA sequence (1695 nucleotides long), shown in between the 2.0kb and 1.5kb size on the 1kb ladder.However there are other faint bands seen, which are signs of contaminants and gel extraction might have to be done to refine the DNA after PCR Squared.
Lab 9: Primary PCR (Worked)
Primary PCR results show a hazy band that is prevalent from 2.0kb to 100 bp area, however most of the DNA seems to be residing at the bottom. The DNA that is seen at the bottom of the band is probably the tail primers that didn't latch onto the DNA of the protein properly. This Primary PCR result is acceptable, however, because there is a substantial amount of DNA around the 500 bp region, meaning the tail primers were able to latch onto the STPP-2b DNA and the polymerase was able to synthesize bands which will be further refined to my DNA size in secondary PCR.
Week 3 & 4
Gautam - good work. Include a ladder image. Move analysis outside of the caption - Dr. B 092513
Lab 8: Primary PCR
Trials 1 & 2. Primary PCR was run twice, both of which failed. The first trial, no bands showed up at all. The second trial, a small blurry trail showed at bottom, but probably only is a clump of primers found below and not the actual piece of DNA required before running Secondary PCR. Third trial will be run next week.
Lab 7: Tail Primer Design
Tail Primers were created that had similar melting points within 0.5 degrees Celcius of each other. Purpose of lab is to make tail primers to order and also to insert the gene sequence of P. Vivax STTP-2B into pNIC BSA-4.
Forward Primer: TACTTCCAATCCATGGAACCGCTCCCAAATCCA
Reverse Primer: CGCCCACCGAACGAATGACAGTAAAGGTGGATA
Lab 6: Oligo Mix Dilution
Oligonucleotide mix was made using 42 wells from the box. Final volume was 100uL.
Lab 5: RE Digest & Redo PCR Results
Restriction Enzymes EcoRI and PvuII were used to cleave DNA at different restriction sites. The further the bands travelled, the shorter the DNA strands were. The 1KB ladder was used to show the different sizes for the DNA strands.
Week 1 & 2
Gautam , good job, include image of your failed gel.. Re-do PCR - Dr. B 090913
Lab 4: PCR and Agarose Gel Preparation
Results from first attempt Failed. Probably due to not diluting the Taq before adding it into the samples.
Lab 3: PCR Oligo (Primer) Design
----------------------------------------------------------------
42 oligonucleotides need to be synthesized
----------------------------------------------------------------
1 ATGGAGCCACTGCCAAACCCGAAGAATGATCGTCAGGTTAAGGATGTTGA 50
2 AGAGCAGCTCCAGAGACAGTGGTTTTGCTGGTGGTGGTTCAACATCCTTAACCTGACGAT 60
3 CTGTCTCTGGAGCTGCTCTACCCGAACGGTACGGACGAGCCACCGGATTACAAGGCTCTG 60
4 CCTCTTTACGGATACGACCTTCTTTTTTGAGATGATCACGCAGAGCCTTGTAATCCGGTG 60
5 AAGGTCGTATCCGTAAAGAGGACTGTCTGGACATTATCAAACGTGTTATCGACATCGTAT 60
6 ATCGGGTCCTGCAGACGCAGGAGGTTCGGTTCGTTAGATACGATGTCGATAACACGTTTG 60
7 CGTCTGCAGGACCCGATTACCATCGTTGGCGACATCCATGGCCAGTACTACGACTTCCTG 60
8 ACTGAGTGTTGTCCGGGTTACCACCTACCTCCAGGAGTTTCAGGAAGTCGTAGTACTGGC 60
9 ACCCGGACAACACTCAGTTTCTCTTCCTGGGTGACTACGTCGACCGTGGCTCTTTTTCTA 60
10 AAGTTAATCTTGAGGGCGTACAGGAGGAGCAGGACTTCGATAGAAAAAGAGCCACGGTCG 60
11 TGTACGCCCTCAAGATTAACTTCCCGCACAAAATCTGGCTGATCCGTGGCAACCACGAAT 60
12 TCGCACTCGTCACGAAAGTTGAAAAAGGAGGTCATCTGACGGCATTCGTGGTTGCCACGG 60
13 CTTTCGTGACGAGTGCGAATACAAATACGACATGGTTGTTTACTACGCGTTCATGGAATC 60
14 TACCGTTGATAACCGCAGACAGCGGGATGGTGTCGAAAGATTCCATGAACGCGTAGTAAA 60
15 GTCTGCGGTTATCAACGGTAAATTCCTGGCCGTTCACGGTGGTCTGTCTCCACAGCTGGT 60
16 GCTCTTGAAAACGGGTAAAGCTGCAGATTTGGTTCAGCAGAACCAGCTGTGGAGACAGAC 60
17 GCTTTACCCGTTTTCAAGAGCCGCCACGCTCTGGTATTTTCTGTGACATCCTGTGGGCAG 60
18 CGGTCTGGATGGTATGTTCTTCTTTGTCTTCGTCGATTGGATCTGCCCACAGGATGTCAC 60
19 AAGAACATACCATCCAGACCGAATCTTACTTTCCGAATGATATCCGCGGCTGTTCCTACT 60
20 CCGTTTTTTTCCAGAAAAGTGGTCGCTGCGTTGTAACCGAAAAAGTAGGAACAGCCGCGG 60
21 CCACTTTTCTGGAAAAAAACGGTCTGCTGTCTATCATCCGTGCCCACGAGGCGCAACTGG 60
22 CGGGAAACCGGTCTTCAGGTTGGTTTGGTGCATCTTATAACCTTCCAGTTGCGCCTCGTG 60
23 CTGAAGACCGGTTTCCCGATCGTTATCACTATCTTCTCTGCACCGAACTATTGCGACGTA 60
24 TGTTAGAGTCGAATTTCAGAACCGCACCTTTGTTATTGTATACGTCGCAATAGTTCGGTG 60
25 GGTTCTGAAATTCGACTCTAACACCCTGAACATCCAGCAGTTCTCTTTCTCTCCGCACCC 60
26 GAGACCAGGTAAACAGGTTCATAAAGTTCGGGAGGTGATAAGGGTGCGGAGAGAAAGAGA 60
27 TGAACCTGTTTACCTGGTCTCTGCCGTTTGTTAGCGAAAAGGTGACCGAAATGCTGTACT 60
28 ACACCTTCGTCAGACTGGTTAACAGAAGAGTTCAGAATGCAGTACAGCATTTCGGTCACC 60
29 ACCAGTCTGACGAAGGTGTTAAAGATGTCGTTCTGCCTGCCGAAGTTCTGCAAATTATCT 60
30 CATACCCTCGAGTTTAACGTTGTTTTCTTCGATGTAAGAGATAATTTGCAGAACTTCGGC 60
31 CAACGTTAAACTCGAGGGTATGACCCTGAGCGGTGGCGGTGGTGCGACTGCCGGTGCGGC 60
32 TTCCTTACGTTGAGAAGACGGAGAACCTTCGGTAGCACCAGTGGATGCCGCACCGGCAGT 60
33 CCGTCTTCTCAACGTAAGGAAGCCCTCTTCAAAGAGGGTTGCTTTCACTCTGGTGCCAGC 60
34 GCCGCTGCCGGAGACGTGGTACCCAGGGCACCGCCTTCCTTGCTGGCACCAGAGTGAAAG 60
35 GTCTCCGGCAGCGGCGACGGCTACCACCCAGCAGATGGCAGCGCAAGGTGAGCAACCGGC 60
36 AGAACGCTCTTTAGACGCCTGCGCGTCGTCGGTGTGCAGGTGTGCCGGTTGCTCACCTTG 60
37 GGCGTCTAAAGAGCGTTCTGACGCGCTCCGCAAAAAGGTTCAATCTGTTGGCCGTCTCAT 60
38 AATCAGTTCATTTTCTTTGCGCAGAGTACGGAAAACACGCATGAGACGGCCAACAGATTG 60
39 GCGCAAAGAAAATGAACTGATTGTTCAACTCAAAGGTTGTTCTCCAGGTTACCGCATTCC 60
40 CGTTCTCGAGGCCCTCCTTGCCCTGCAGCAGGAGACCTACCGGAATGCGGTAACCTGGAG 60
41 GGAGGGCCTCGAGAACGAACTCGAAAAATTCACTAAAGCTAAACAGATCGACAGCATCAA 60
42 TTACTCGTTCGGAGGACGTTTTTCATTGATGCTGTCGATCTGTTTAG 47
Figure 3.1: Primer Design sequence used to order Oligonucleotides. The primer sequence of Serine/Threonine Protein Phosphatase 2B, putative in P. Vivax that was codon optimized for E. Coli class II.
Week 1
Lab 2: DNA Sequence Sent to DNA Sequencing Facility:
DNA Plasmid: pGBR-22 using M13F
DNA Sequence:
NNNNNNNNNNNNNGGCGATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCCGCGGGATTTTAGTGATGGTGATGGTGATGACCGAGCAAAGAGTGGCGTGCAATGGATATTTCACACTGCTCAACA
AATGTGTAATCCTTGTTGTGACTGGTTACATCCAGTTTGCGGTCAACATAGTGATACCCTGGCATCCTCACAGGCTTCTTTGCCTTGTAAGTAGATTTGAATTCACACAAATAGTAACCACCTCCTTCCAACTTCA
GAGCCATAAAGTTGTTTCCTATCAGCATTCCATCTCGTGCAAAGAGACGCTCAGTGTTGGGTTCCCAGCCCTGTGTCTTCTTCTGCATAACAGGTCCATTGGGAGGAAAGTTCACACCAGAGATTTTGACATTG
TAGATGAAACAGTTGCCTTGGATGCTGGAATCATTGCTGACAGTACACACTGCACCATCTTCAAAGTTCATGATCCTCTCCCATGTATATCCCTCAGGGAATGACTGCTTTACATAATCAGGGATGTCTTCAGG
GTACTTGGTGAATGGTATGCTTCCGTATTGAGACAGTGGTGATAAAATATCCCAAGCAAATGGCAGAGGTCCACCCTTGGTGACAGTGAGCTTTACCGTCTGCTCCCCCTCGTAAGGCTTTCCTTTTCCATCG
CCTTCGACCTCAAAGTAGTGTCCATTGACCGTGCCTGACATATAAACCTTGTANGTCATTTGTTTAGCGATCACACTCATGATATTTCTCCTTCAATCAATCAAAATCACTAGTGCGGCCGCCTGCAGGTCGAC
CATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCNCTCACAATTCCACACAACAT
ACNAGCCGGAAGCATAAAGTGNAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCNCATTAATTGCGTTGCNCTCACTGCCNGCTTNCNGTNGGAAANCTGTCGTGNNGCTGCNNNNNNANNNNNNNCN
CGGGGNNNNGNNGNTNGCNTNTGGGNNNTNNNNNNNNCGNNNNNNGANTCNNNNCNNNNNNNCNTNNGNNGCGGNNNNNNGNNTCNNNTNNNNNNNNNNNNNNNGNNNNNNNNNNAANTCNNG
NNNNNCNNAANNNNNNNNNNNNNNNNNNNNNNNNANCNNNNNNNCNNNNTNNNNNNTNNNNNNNNNNNN
Figure 2.1: DNA sequence of pGBR-22 using primer M13-Forward. Results were obtained from DNA Sequencing Lab. A,G,C,T represent base pairs while N represents base pairs that sequencing lab was unable to distinguish.
Lab 1: Nanodrop: